Boerrigter [43] has studied the economics of BTL plant to produce green biodiesel

from biomass using an integrated back-end approach to the plant design. His main

conclusions are as follows:

1. Fixed cost for BTL plant is generally 60% higher than the one required for GTL plant of the same size. This is because the requirements of larger air separation unit, 50% more expensive gasifier because of the special solids handling, and the requirement of Rectisol unit for bulk gas cleaning.

2. BTL plants of 1,000-5,000 MWth (size of gasifiers) are optimal.

3. For production below 20,000 Bbld, fixed costs increase very rapidly.

4. The heart of BTL plant is a pressurized oxygen-blown slagging entrained flow gasifier. This technology is identified as an optimum technology for biosyngas production.

5. Torrefaction is the optimum biomass pretreatment technology for the entrained fl ow gasi fi cation.

6. Commercially available technologies can be used for the biosyngas cleaning and conditioning as well as for FT synthesis (both fixed bed and slurry bed).

7. Large-scale facilities are required to take advantage of economy of scale. The increase in transportation cost to provide large-scale facility is less important than decrease in fixed plant costs. For a large-scale process, the diesel generated from BTL plant is competitive with $60/bbl oil price.

The results of CO2 selectivity shown in Fig. 7 only indicate that the Fe catalysts with high Zn/K ratio or low K content possess the possibility to use CO2 contained in syngas for hydrocarbon synthesis at low temperature because the exact conversion from CO2 to hydrocarbons cannot be decided in our experiments. Therefore, Z4K1C4/Fe and Z4K2C4/Fe were assessed under the reactants of CO2 and H2 in order to investigate the influence of Zn/K ratio on CO2 hydrogenation [42].

Z4K1C4/Fe produces more C2+ hydrocarbons than Z4K2C4/Fe, it indicates that the catalyst with higher Zn/K ratio is more active to hydrogenate CO2 indirectly [9, 11, 18] or directly.

Furthermore, Z4K1C4/Fe shows similar activity and selectivity to those studied under 523 K [56], 538 K [30], or 623 K [33]. Based on the experimental results, we pointed out that it is possible to use CO2 contained in syngas for hydrocarbon synthesis at low temperature by the help of suitable promoter(s) [42].

1.2 Conclusions

CO2-TPD indicates that adsorbed CO2 on promoted Fe catalysts can partly be converted into CO. Promoter K or Zn is able to increase the adsorption of CO2 because more CO2 and CO are desorbed from K2/Fe and Z4/Fe than that from unpromoted Fe catalyst. K mainly increases CO2 adsorption and is inferior to Zn in producing CO.

Cu has no strong effect on CO2-TPD. For the Fe catalysts copromoted by Zn, K, and Cu, the desorbed amount of CO2 closely relies on the content of K although the content of Zn and Cu has effect on the amount of desorbed CO2. The desorbed CO2 from the tri-promoted catalysts with 2 mass% K is higher than the mono-promoted Fe catalyst by Zn or K, whereas the corresponding peak diminishes with the K content decreased to 1 mass%.

The combined promoters changes the CO desorption pattern evidently. The cata­lysts with high Zn/K ratio or low K content possess desorbed CO peak around 930 K. This peak reflects the possibility whether CO2 added into syngas can influence CO2 selectivity in FT synthesis. For the catalysts showing desorbed CO around 930 K, their CO2 selectivity based on converted CO is decreased due to the added CO2 in syngas.

The Fe catalyst with high Zn/K ratio shows high C2+ hydrocarbon selectivity for CO2 hydrogenation. It indicates that the CO2 contained in syngas is able to be activated by suitable promoter(s) for hydrocarbon synthesis at low temperature.

In a recent economic study on production of butanol from WSH, it was identified that utility costs are one of the most significant factors that impact price of butanol. This was largely due to distillative recovery of butanol from fermentation broth. Wheat straw was treated using dilute sulfuric acid at 121°C and hydrolyzed using enzymes prior to fermentation to butanol. Fermentation was performed in batch reactors employing C. beijerinckii P260 followed by recovery by traditional distil­lation. It was estimated that distillative recovery of butanol would result in the production price of $1.37/kg ($4.26/gal) for a grass rooted/or green field plant while for an annexed plant this price would reduce to $1.07/kg ($3.33/gal). Recovery of butanol using a pervaporation membrane would further reduce this price to $0.82/kg ($2.55/gal). This price is based on 2010 equipment purchase cost. In an interesting report, commercial production of acetone-butanol was achieved in Russia (then Soviet Union) from hemp waste, corncobs, and sunflower shells [76]. In addition to acetone-butanol, equal emphasis was placed on recovery of gases, vitamin B12, and methane production by digesting the effluent waste thus benefiting from all these coproducts which added to the profitability of the AB plant.

Acknowledgments N. Qureshi would like to thank Michael A. Cotta (United States Department of Agriculture, National Center for Agricultural Utilization Research, Bioenergy Research Unit, Peoria, IL) for reading this manuscript and providing valuable and constructive comments. Part of this work was supported by the hatch grant (Project No: OHO01222; Department of Animal Sciences, The Ohio State University) to T. C. Ezeji.

Novel strategies for silent lignin modification with minimal impacts on plant development have been initiated. For example, applications of temporally con­trolled chemical or biological switches can induce lignin loosening at predeter­mined times. Ralph et al. [99] have developed a chemical insertion of alternative nonnative monolignols to lignin using the combinatorial oxidative coupling mech­anism of lignin biosynthesis. These designed lignins feature weak cleavable bonds termed “zips.” The authors reported incorporation of ferulate-polysaccharides esters in grasses during the lignification process. The resultant grass cell walls were more easily hydrolyzed by enzymes following alkaline treatments than the wild type [99].

Ferulate-monolignol ester conjugates, such as coniferyl ferulate or sinapyl feru — late have not been identified in lignins, but are produced during lignan biosynthesis [46]. Plants successfully incorporated these new monolignols into lignin following the addition of the monolignols to the growing medium and these unique monoli — gnols introduced easily cleavable ester “zips.” Monolignol incorporation into corn cell walls increased saccharification efficiency over that of wild type and reduced the need for the pretreatment stage. Transgenic plants with ferulated monolignol — rich lignins [46, 98] may be produced in the future.

A novel method which increased cellulose accessibility without affecting lignin content or plant structural integrity was recently demonstrated by free radical cou­pling of tyrosine-rich peptides into lignin. The phenol-hydroxyl groups of the tyrosine-rich peptides serve as reactive sites for coupling with the lignin [72]. The resultant lignin has hot spots that are highly susceptible to protease cleavage, allowing enhanced enzymatic hydrolysis and ethanol yields. Liang et al. [72] transformed poplar trees (Populus deltoidesx nigra[ with a tyrosine-rich gene under the poplar phenylalanine ammonia-lyase (PAL2) secondary cell wall pro­moter. The transgenic plants had no changes in total lignin content or overall plant morphology when compared to wild type, but were more susceptible than wild type to protease digestion, and resulted in higher sugar release from the lignocel — lulose complexes [72].

The envisioned transgenic designer algae comprise switchable transgenes wherein each transgene encodes for a proton-conductive channel in the algal photosynthetic thylakoid membrane for enhanced photobiological H2 production. The programma­ble genetic insertion of proton channels into algal thylakoid membrane is achieved by transformation of a host alga with a DNA construct that contains a designer polypeptide proton-channel gene linked with an externally inducible promoter such as a redox-condition-sensitive hydrogenase promoter serving as a genetic switch.

Examples of proton-conductive polypeptide or protein structures that can be used and/or modified for this application are the structures of melittin, gramicidin [18], CF0 protein (the proton channel of chloroplast coupling factor CF0CF1), F0 protein (the proton-channel structure of mitochondrial coupling factor FoF1), and their analogs including artificially designed polypeptide proton channels. That is, the molecular structure (and thus the DNA sequence) of a polypeptide proton chan­nel can be designed according to these natural proton-channel structures and their analogs at a nanometer scale. Melittin is preferred for use in this application since in vitro assay has already demonstrated that melittin can work as a proton channel in thylakoid membrane [19].

As shown in Fig. 4a, the designer proton-channel transgene is a nucleic acid construct from 5′ to 3′ comprising typically: (a) a polymerase chain reaction forward (PCR FD) primer; (b) an externally inducible promoter; (c) a transit target­ing sequence; (d) a designer proton-channel encoding sequence; (e) a transcription and translation terminator; and (f) a PCR reverse (RE) primer.

Another aspect is the innovative application of an externally inducible promoter such as a hydrogenase promoter. To function as intended, the designer proton-chan­nel protein is inducibly expressed under hydrogen-producing conditions such as under anaerobic conditions. An algal hydrogenase promoter, such as the promoter of the hydrogenase gene (Hydl) of C. reinhardtii, can be used as an effective genetic switch to control the expression of the proton channel gene to the exact time and conditions where it is needed for H, production. That is, the proton channels are synthesized only at the time when the hydrogenase is induced and ready for H, production under anaerobic conditions. Therefore, the hydrogenase promoter is employed as an inducible promoter for the DNA construct (Fig. 4a) to serve as a genetic switch to control the expression of the designer polypeptide proton-channel gene. The reason that the designer alga can perform autotrophic photosynthesis using CO, as the carbon source under aerobic condition is because the designer proton-channel gene is not expressed under aerobic conditions owning to the use of a hydrogenase promoter as a genetic switch, which can be turned on only under the anaerobic conditions when needed for photobiological H2 production.

In addition to the hydrogenase promoter, other promoters can also be used to construct the desired genetic switch for designer proton-channel gene. Chlamydomonas cells contain several nuclear genes that are coordinately induced under anaerobic conditions. These include the hydrogenase structural gene itself (Hydl), the Cyc6 gene encoding the apoprotein of Cytochrome c, , and the Cpxl gene encoding coprogen oxidase [20]. The regulatory regions for the latter two have been well characterized, and a region of ~100 bp proves sufficient to confer regula­tion by anaerobiosis in synthetic gene constructs. The promoter strengths of these three genes vary considerably; each may thus be selected to control the level of the designer proton-channel expression for enhanced photobiological production of H2. There are a number of other regulated promoters that can also be used and/or modified to serve as the genetic switches. For example, the nitrate reductase (Nia1)

promoter which is induced by growth in nitrate medium and repressed in nitrate — deficient but ammonium-containing medium is used to control the expression of the designer genes according to the concentration levels of nitrate in a culture medium as well. Therefore, inducible promoters that can be used and/or modified in various embodiments to serve this purpose includes, but are not limited to, hydrogenase promoters, Cytochrome c6 (Cyc6) promoter, Nial promoter, CabII-1 promoter, Cal promoter, Ca2 promoter, coprogen oxidase promoter, and/or their analogs and modi fi ed designer sequences.

Another aspect is the targeted insertion of designer proton channels into algal photosynthetic membrane or into both the photosynthetic membrane and other cel­lular membranes including the mitochondria and/or plasma membranes to suit for the specific applications. For example, in the case of green algae including Chlamydomonas, when recyclable growth of the designer algae culture is desired, it is best to insert the proton channels only into the algal thylakoid membrane, exactly where the action of proton channels is needed to enhance H2 production. If expressed without a targeted insertion mechanism, the polypeptide proton channels might be inserted nonspecifically into other membrane systems including the mitochondria and plasma membranes in addition to the thylakoid membranes. Although an expression of the proton channel gene in such a nonspecific manner could still trans­form an algal cell into a more efficient and robust photosynthetic apparatus for H2 production, other cellular functions such as the respiratory process would probably be disabled because of the potential effect of the proton channels that are nonspecifically inserted into other organelles such as the mitochondria. As a result, this type of algal cells with insertion of the proton channels into both the photosyn­thetic membrane and other cellular membranes, such as the mitochondrial mem­branes, can still be used for enhanced H2 production, but the cells would probably no longer be able to grow or regenerate themselves after the expression of the designer proton channels is turned on. That is, when the expression of the designer proton channels is turned on in this type of nonregenerative proton-channel designer algae, the algal culture will become dedicated “green machine” materials for enhanced H2 production and the cells will no longer be able to grow even if they are returned to aerobic condition because the other cellular functions such as the func­tion of the mitochondria are impaired by the insertion of proton channels.

This nonregenerative feature provides a benefit: help ensure biosafety in using the genetically modified algae. This is because after the designer proton channels are inserted into both the photosynthetic membrane and the mitochondrial mem­branes, the designer algal cells become dedicated nonliving “green machine” mate­rials for enhanced H2 production, but without any potential risks of sexually passing any of their genes to any other cells. In various embodiments, the nonregenerative feature is achieved by use of two designer proton-channel genes: one with a mito­chondrial-targeting sequence to insert proton channels into the algal mitochondrial membrane and one with a thylakoid-targeting sequence to insert proton channels into the algal thylakoid membrane. When the two designer proton-channel genes are both expressed, the designer cells immediately become dedicated nonliving “green machine” materials for enhanced H2 production. Therefore, in one embodi­ment, it is a preferred practice to keep growing this type of nonregenerative proton — channel designer under aerobic conditions to continuously supply batches of grown designer algal cultures that are subsequently used for enhanced H2 production expression of the proton channels into both the photosynthetic membrane and other cellular membranes such as the mitochondrial membranes under anaerobic condi­tions. After the nonregenerative proton-channel designer algal cultures are used for enhanced H2 production under anaerobic conditions, they can be quite safely han­dled as nonliving biomass materials for disposal including possible use as a fertil­izer or other biomass processes.

With a thylakoid-targeted mechanism that enables insertion of the polypeptide proton channels only into the thylakoid membrane so that all of the other cellular functions (including functions of the mitochondria, nucleus, and cell membranes) are kept intact, the result can be much better for certain applications. After the thy — lakoid-targeted insertion of proton channels, the cell will not only be able to pro­duce H2 , but also to grow and regenerate itself when it is returned to aerobic conditions. Our daily experience with photoheterotrophically grown photosynthetic mutants of algae with acetate-containing culture media has demonstrated that this type of designer alga, which contains normal mitochondria, should be able to use the reducing power (NADH) from organic reserves (and/or some exogenous organic substrate such as acetate) to power the cell immediately after its return to aerobic conditions. Consequently, when the alga is returned to aerobic conditions after its use under anaerobic conditions for photoevolution of H2 and O2, the cell will stop making the polypeptide proton channels and start to restore its normal photoauto­trophic capability by synthesizing new and functional thylakoids. Consequently, it is also possible to use this genetically transformed organism for repeated cycles of photoautotrophic growth under normal aerobic conditions and efficient production of H2 and O2 by photosynthetic water splitting under anaerobic conditions.

Targeted insertion of designer proton channel is accomplished through the use of a specific targeting DNA sequence that is located between the promoter and the designer proton-channel DNA as shown in the DNA construct (Fig. 4a). In various embodiments, there are a number of transit peptide sequences that can be selected and/or modified for use as the targeting sequence for the targeted insertion of the designer proton channels into algal photosynthetic membrane and, when desirable, other cellular membranes, such as mitochondrial membrane. The targeting sequences that can be used and/or modified for this purpose include (but are not limited to) the transit peptide sequences of: plastocyanin apoprotein (Pcyl), the LhcII apoproteins, OEE1 apoprotein (PsbO) , OEE2 apoprotein (PsbP) , OEE3 apoprotein (PsbQ), hydrogenase apoproteins (such as Hydl), PSII-T apoprotein (PsbT), PSII-S apopro­tein (PsbS), PSII-W apoprotein (PsbW), CF0CF1 subunit-g apoprotein (AtpC), CF0CF1 subunit-5 apoprotein (AtpD), CF0CF1 subunit-II apoprotein (AtpG), photo­system I (PSI) apoproteins (such as, of genes PsaD, PsaE, PsaF, PsaG, PasH, and PsaK), Rubisco SSU apoproteins (such as RbcS2), a-tubulin (TubA), b-tubulin (TubB2), mitochondrial carbonic anhydrase apoproteins (Ca1 and Ca2), and/or their analogs and modified designer sequences.

The following are examples of transit peptide sequences that could be chosen to guide the genetic insertion of the designer proton channels into algal thylakoid membrane: (1) The transit peptide from the plastocyanin gene targets the lumen of the thylakoids from which the biochemical properties of the designer proton-chan­nel polypeptide may again generate insertion into the thylakoid membrane; (2) The Hydl transit peptide confers importation of polypeptides into the stroma, from which the biochemical properties of the designer proton-channel protein may gener­ate insertion into the thylakoid; (3) The transit peptides from the recently character­ized Lhcb gene family members [21] lead the LhcII apoproteins directly to the thylakoid and may also do so for the designer proton-channel polypeptide in an artificial construct; and (4) The transit peptide from the Cyc6 gene targets the lumen of the thylakoids from which the biochemical properties of the designer proton — channel polypeptide may again generate insertion into the thylakoid.

As illustrated in Fig. 4a, the designer DNA construct also contains a terminator after the proton-channel encoding sequence and a pair of PCR [22] primers located each at the two ends of the DNA construct. The terminator DNA sequence, which is designed based on the sequences of natural gene terminators, is to ensure that the transcription and translation of the said designer proton-channel gene is properly terminated to produce an exact designer proton-channel protein as desired.

The two PCR primers are a PCR FD primer located at the beginning (the 3′ end) of the DNA construct and a PCR RE primer located at the other end as shown in Fig. 4a. This pair of PCR primers is designed to provide certain convenience when needed for relatively easy PCR amplification of the designer DNA construct, which is helpful not only during and after the designer DNA construct is synthesized in preparation for gene transformation, but also after the designer DNA construct is delivered into the genome of a host alga for verification of the designer proton — channel gene in the transformants. For example, after the transformation of the designer gene is accomplished in a C. reinhardtii-arg7 host cell using the techniques of electroporation and argininosuccinate lyase (arg7) complementation screening, the resulted transformants can be then analyzed by a PCR DNA assay of their nuclear DNA using this pair of PCR primers to verify whether the entire designer proton-channel gene (the DNA construct) is successfully incorporated into the genome of a given transformant. When the nuclear DNA PCR assay of a transfor­mant can generate a PCR product that matches with the predicted DNA size and sequence according to the designer DNA construct, the successful incorporation of the designer proton-channel gene into the genome of the transformant is verified.

Using the molecular genetics arts described above, we designed and synthesized a number of designer proton-channel genes in collaboration with certain gene-syn­thesizing companies including Geneart USA. Figure 4b shows our first set of designer proton channel genes that were synthesized through collaboration with Geneart. The following presents some examples of the designer proton-channel genes (DNA constructs) that have synthesized and tested in genetic transformation experiments.

Figure 5a presents SEQ ID No. 1: example 1ofa detailed DNA construct of a designer proton-channel gene that includes a PCR FD primer (1-20), a 458-bp HydAl promoter (21-478), a Plastocyanin transit peptide DNA sequence (479-618), a Melittin DNA sequence (619-703), an RbcS2 terminator (704-926), and a PCR RE primer (927-945). This DNA construct (example 1) has been delivered into the nuclear genome of a C. reinhardtii-arg7 host cell using the techniques of electropo­ration and arg7 complementation screening to create the proton-channel designer alga. The 458-bp HydA1 promoter (DNA sequence 21-478) is used as an example of an inducible promoter to control the expression of a Melittin proton channel (DNA sequence 619-703). The RbcS2 terminator (DNA sequence 704-926) is employed to ensure that the transcription and translation of the proton-channel gene is properly terminated to produce the exact designer proton-channel protein

a

AGAAAATCTGGCACCACACCAT AAGGGTCAT AGAATCT AGCGTT ATCCTTCCA

CGAGCGTGTGGCAGCCTGCTGGCGTGGACGAGCTGTCATGCGTTGTTCCGTTAT

GTGTCGTCAAACGCCTTCGAGCGCTGCCCGGAACAATGCGTACTAGTATAGGA

GCCATGAGGCAAGTGAACAGAAGCGGGCTGACTGGTCAAGGCGCACGATAGG

GCTGACGAGCGTGCTGACGGGGTGTACCGCCGAGTGTCCGCTGCATTCCCGCC

GGATTGGGAAATCGCGATGGTCGCGCATAGGCAAGCTCGCAAATGCTGTCAGC

TTATCTTACATGAACACACAAACACTCTCGCAGGCACTAGCCTCAAACCCTCGA

AACCTTTTTCCAACAGTTTACACCCCAATTCGGACGCCGCTCCAAGCTCGCTCC

GTTGCTCCTTCATCGCACCACCTATTATTTCTAATATCGTAGACGCGACAAG^rG

AAGGCTACTCTGCGTGCCCCCGCTTCCCGCGCCAGCGCTGTGCGCCCCGTCGCC

AGCCTGAAGGCCGCTGCTCAGCGCGTGGCCTCGGTCGCCGGTGTGTCGGTTGCC

TCTCTGGCCCTGACCCTGGCTGCCCACGCCATGGCCGGCATCGGCGCCGTGCTG

AAGGTCCTGACCACCGGCCTGCCCGCCCTGATCAGCTGGATCAAGCGCAAGCG

CCAGCAGTAAATGGAGGCGCTCGTTGATCTGAGCCTTGCCCCCTGACGAACGG

CGGTGGATGGAAGATACTGCTCTCAAGTGCTGAAGCGGTAGCTTAGCTCCCCGT

TTCGTGCTGATCAGTCTTTTTCAACACGTAAAAAGCGGAGGAGTTTTGCAATTT

TGTTGGTTGTAACGATCCTCCGTTGATTTTGGCCTCTTTCTCCATGGGCGGGCTG

GGCGTATTTGAAGCGGTTCTCTCTTCTGCCGTT

b

AGAAAATCTGGCACCACACCGAGCTGTCATGCGTTGTTCCGTTATGTGTCGTC

AAACGCCTTCGAGCGCTGCCCGGAACAATGCGTACTAGTATAGGAGCCATGAG

GCAAGTGAACAGAAGCGGGCTGACTGGTCAAGGCGCACGATAGGGCTGACGA

GCGTGCTGACGGGGTGTACCGCCGAGTGTCCGCTGCATTCCCGCCGGATTGGG

AAATCGCGATGGTCGCGCATAGGCAAGCTCGCAAATGCTGTCAGCTTATCTTAC

ATGAACACACAAACACTCTCGCAGGCACTAGCCTCAACTCGAGCAT^rGAAGG

CTACTCTGCGTGCCCCCGCTTCCCGCGCCAGCGCTGTGCGCCCCGTCGCCAGCC

TGAAGGCCGCTGCTCAGCGCGTGGCCTCGGTCGCCGGTGTGTCGGTTGCCTCTC

TGGCCCTGACCCTGGCTGCCCACGCCATGGCCGGCATCGGCGCCGTGCTGAAG

GTCCTGACCACCGGCCTGCCCGCCCTGATCAGCTGGATCAAGCGCAAGCGCCA

GCAGTAATCTAGATAAATGGAGGCGCTCGTTGATCTGAGCCTTGCCCCCTGACG

AACGGCGGTGGATGGAAGATACTGCTCTCAAGTGCTGAAGCGGTAGCTTAGCT

CCCCGTTTCGTGCTGATCAGTCTTTTTCAACACGTAAAAAGCGGAGGAGTTTTG

CAATTTTGTTGGTTGTAACGATCCTCCGTTGATTTTGGCCTCTTTCTCCATGGGC

GGGCTGGGCGTATTTGAAGCGGTTCTCTCTTCTGCCGTT

Fig. 5 (a) DNA sequence IDNo. 1: A detailed DNA construct of a designer proton-channel gene (945 bp) that includes a polymerase chain reaction forward (PCR FD) primer (1-20), a 458-bp HydAl promoter (21-478), a Plastocyanin transit peptide DNA sequence (479-618), a Melittin DNA sequence (619-703), an RbcS2 terminator (704-926), and a PCR reverse (RE) primer (927­945). (b) DNA sequence ID No. 2: A designer proton-channel gene sequence design (787 bp) that includes (from 5′ to 3′): a PCR FD primer (sequence 1-20), a 282-bp HydAl promoter (21-302), a Xho I Ndel site (303-311), a Plastocyanin transit peptide sequence (312-452), a Melittin proton channel (453-536), a Xbal site (537-545), a RbcS2 terminator (546-768), and a PCR RE primer (769-787). (c) DNA sequence ID No. 3: A designer proton-channel gene sequence design (972 bp) that includes (from 5′ to 3 ‘): a PCR FD primer (1-20), a 458-bp HydAl promoter (21-478), a HydAl transit peptide (479-646), a Melittin (647-730), an RbcS2 terminator (731-953), and a PCR RE primer (954-972)

c

AGAAAATCTGGCACCACACCATAAGGGTCATAGAATCTAGCGTTATCCTTCCA

CGAGCGTGTGGCAGCCTGCTGGCGTGGACGAGCTGTCATGCGTTGTTCCGTTAT

GTGTCGTCAAACGCCTTCGAGCGCTGCCCGGAACAATGCGTACTAGTATAGGA

GCCATGAGGCAAGTGAACAGAAGCGGGCTGACTGGTCAAGGCGCACGATAGG

GCTGACGAGCGTGCTGACGGGGTGTACCGCCGAGTGTCCGCTGCATTCCCGCC

GGATTGGGAAATCGCGATGGTCGCGCATAGGCAAGCTCGCAAATGCTGTCAGC

TTATCTTACATGAACACACAAACACTCTCGCAGGCACTAGCCTCAAACCCTCGA

AACCTTTTTCCAACAGTTTACACCCCAATTCGGACGCCGCTCCAAGCTCGCTCC

GTTGCTCCTTCATCGCACCACCTATTATTTCTAATATCGTAGACGCGACAAGAT

GTCGGCGCTCGTGCTGAAGCCCTGCGCGGCCGTGTCTATTCGCGGCAGCTCCTG

CAGGGCGCGGCAGGTCGCCCCCCGCGCTCCGCTCGCAGCCAGCACCGTGCGTG

TAGCCCTTGCAACACTTGAGGCGCCCGCACGCCGCCTAGGCAACGTCGCTTGCG

CGGCTATGGCCGGCATCGGCGCCGTGCTGAAGGTCCTGACCACCGGCCTGCCC

GCCCTGATCAGCTGGATCAAGCGCAAGCGCCAGCAGTAAATGGAGGCGCTCGT

TGATCTGAGCCTTGCCCCCTGACGAACGGCGGTGGATGGAAGATACTGCTCTCA

AGTGCTGAAGCGGTAGCTTAGCTCCCCGTTTCGTGCTGATCAGTCTTTTTCAAC

ACGTAAAAAGCGGAGGAGTTTTGCAATTTTGTTGGTTGTAACGATCCTCCGTTG

ATTTTGGCCTCTTTCTCCATGGGCGGGCTGGGCGTATTTGAAGCGGTTCTCTCT

TCTGCCGTT

Fig. 5 (continued) (Melittin) as desired. Because the HydAl promoter is a nuclear DNA that can con­trol the expression only for nuclear genes, the synthetic proton-channel gene in this example is designed according to the codon usage of Chlamydomonas nuclear genome. Therefore, in this case, the designer proton-channel gene is transcribed in nucleus. Its mRNA is naturally translocated into cytosol, where the mRNA is trans­lated to an apoprotein that consists of the Melittin protein (corresponding to DNA sequence 619-703) and the Plastocyanin transit peptide (corresponding to DNA sequence 479-618) linked together. The transit peptide of the apoprotein guides its transportation across the chloroplast membranes and into the thylakoids, where the transit peptide is cut off from the apoprotein and the resulting free melittin (poly­peptide proton channel) insert itself into the thylakoid membrane from the lumen side. The action of the designer proton channel in the thylakoid membranes then provides the benefit of simultaneously eliminating the four proton gradient-related problems in relation to photobiological H2 production. The two PCR primers (sequences 1-20 and 927-945) are selected from the sequence of a Human actin gene and can be paired with each other. Blasting the sequences against Chlamydomonas GenBank found no homologous sequences of them. Therefore, they can be used as appropriate PCR primers in DNA PCR assays for verification of the designer proton-channel gene in the transformed alga.

Figure 5b presents SEQ ID No. 2: example 2ofa designer proton-channel DNA construct that includes a PCR FD primer (sequence 1-20), a 282-bp HydAl promoter (21-302), a Xho I Ndel site (303-311), a Plastocyanin transit peptide sequence (312-452), a Melittin proton channel (453-536), a XbaI site (537-545), a RbcS2 terminator (546-768), and a PCR RE primer (769-787). This designer proton chan­nel gene (example 2) is quite similar to example 1, SEQ ID No: 1, except that a shorter promoter sequence is used and restriction sites of Xho I Ndel and XbaI are added to make the key components such as the targeting sequence (312-452) and proton channel (453-536) as a modular unit that can be flexible replaced when nec­essary to save cost of gene synthesis and enhance work productivity. Note, the proton channel does not have to be a Melittin; a number of other proton-channel structures such as a gramicidin analog channel can also be used. This designer proton-channel gene (SEQ ID No: 2) has also been successfully delivered into the nuclear genome of a C. reinhardtii-arg7 host cell using the techniques of electroporation and arg7 complementation screening to create the proton-channel designer alga.

Figure 5c presents SEQ ID No. 3: example 3ofa designer proton-channel DNA construct that includes a PCR FD primer (1-20), a 458-bp HydAl promoter (21­478), a HydA1 transit peptide (479-646), a Melittin (647-730), an RbcS2 terminator (731-953), and a PCR RE primer (954-972). This designer proton-channel gene (example 3) is also similar to example 1, with the exception that a HydA1 transit peptide sequence (479-646) is used here so that the proton channel protein is syn­thesized in the cytosol, delivered into the chloroplast, and inserted into the thylakoid membrane from the stoma side. This designer proton-channel gene (SEQ ID No: 3) has also been successfully delivered into the nuclear genome of an algal host cell to create the proton-channel designer alga.

Using these designer proton channel genes in genetic transformation of C. rein — hardtii host cells, many transformants have been generated (Fig. 6). Theoretically, these transformants are expected to contain the envisioned proton-channel designer alga that could provide significant impact (tenfold improvement) on technology development in the field of renewable photobiological H2 production. Next, we need to screen/characterize these transformants to identify and optimize the desired pro­ton-channel designer alga with iterative improvement through our progressive feed­back approach of computer-assisted molecular design, designer gene expression, and experimental characterization/verification until the desired result for enhanced photobiological H2 production is achieved.

The designer photosynthetic organisms with designer Calvin-cycle channeled pho­tosynthetic NADPH-enhanced pathways (Figs. 1 and 4-10) can be used with pho­tobioreactors for production and harvesting of butanol and/or related higher alcohols. The said butanol and/or related higher alcohols are selected from the group consist­ing of: 1-butanol, 2-methyl-1-butanol, isobutanol, 3-methyl-1-butanol, 1-hexanol, 1-octanol, 1-pentanol, 1-heptanol, 3-methyl-1-pentanol, 4-methyl-1-hexanol, 5-methyl-1-heptanol, 4-methyl-1-pentanol, 5-methyl-1-hexanol, 6-methyl-1- heptanol, and combinations thereof.

The said designer photosynthetic organisms such as designer transgenic oxypho — tobacteria and algae comprise designer Calvin-cycle-channeled and photosynthetic NADPH-enhanced pathway gene(s) and biosafety-guarding technology for enhanced photobiological production of butanol and related higher alcohols from carbon dioxide and water. According to one of the various embodiments, it is a preferred practice to grow designer photosynthetic organisms photoautotrophically using car­bon dioxide (CO2) and water (H2O) as the sources of carbon and electrons with a culture medium containing inorganic nutrients. The nutrient elements that are com­monly required for oxygenic photosynthetic organism growth are: N, P, and K at the concentrations of about 1-10 mM, and Mg, Ca, S, and Cl at the concentrations of about 0.5-1.0 mM, plus some trace elements Mn, Fe, Cu, Zn, B, Co, Mo among others at pM concentration levels. All of the mineral nutrients can be supplied in an aqueous minimal medium that can be made with well-established recipes of oxy­genic photosynthetic organism (such as algal), culture media using water (freshwater for the designer freshwater algae; seawater for the salt-tolerant designer marine algae), and relatively small of inexpensive fertilizers and mineral salts such as ammonium bicarbonate (NH4HCO3) (or ammonium nitrate, urea, ammonium chlo­ride), potassium phosphates (K2HPO4 and KH2PO4), magnesium sulfate heptahy — drate (MgSO4.7H2O), calcium chloride (CaCl2), zinc sulfate heptahydrate (ZnSO4.7H2O), iron (II) sulfate heptahydrate (FeSO4.7 H2O), and boric acid (H3BO3), among others. That is, large amounts of designer algae (or oxyphotobacteria) cells can be inexpensively grown in a short period of time because, under aerobic condi­tions such as in an open pond, the designer algae can photoautotrophically grow by themselves using air CO2 as rapidly as their wild-type parental strains. This is a significant feature (benefit) of the invention that could provide a cost-effective solu­tion in generation of photoactive biocatalysts (the designer photosynthetic biofuel — producing organisms such as designer algae or oxyphotobacteria) for renewable solar biofuel energy production.

According to one of the various embodiments, when designer photosynthetic organism culture is grown and ready for photobiological production of butanol and/ or related higher alcohols, the designer photosynthetic organism cells are then induced to express the designer Calvin-cycle channeled photosynthetic NADPH — enhanced pathway(s) to photobiologically produce butanol and/or related higher alcohols from carbon dioxide and water. The method of induction is designer path­way gene(s) specific. For example, if/when a nirA promoter is used to control the designer Calvin-cycle channeled pathway gene(s) (such as those of SEQ ID NOS: 58-69, 72, and 73 listed in US Patent Application Publication No. 2011/0177571 A1) which represent a designer transgenic Thermosynechococcus that comprises the designer genes of a Calvin-cycle 3-phophoglycerate-branched photosynthetic NADPH-enhanced pathway (numerically labeled as 34,35,03-05,36-42, and 12 in Fig. 4) for photobiological production of 1-butanol from carbon dioxide and water, the designer transgenic Thermosynechococcus is grown in a minimal liquid culture medium containing ammonium (but no nitrate) and other inorganic nutrients. When the designer transgenic Thermosynechococcus culture is grown and ready for pho­tobiological production of biofuel 1-butanol, nitrate fertilizer will then be added into the culture medium to induce the expression of the designer nirA-controlled Calvin-cycle-channeled pathway to photobiologically produce 1-butanol from carbon dioxide and water in this example.

For the designer photosynthetic organism(s) with anaerobic promoter-controlled pathway(s) such as the designer transgenic Nostoc that contains designer hox — promoter-controlled Calvin-cycle 3-phophoglycerate-branched pathway genes of SEQ ID NOS: 104-109 (listed in US Patent Application Publication No. 2011/0177571 A1), anaerobic conditions can be used to induce the expression of the designer pathway gene(s) for photobiological production of 2-methyl-1-butanol from carbon dioxide and water (Fig. 5). That is, when the designer transgenic Nostoc culture is grown and ready for photobiological biofuel production, its cells will then be placed (or sealed) into certain anaerobic conditions to induce the expression of the designer hox-controlled pathway gene(s) to photobiologically produce 2-methyl — 1-butanol from carbon dioxide and water.

For those designer photosynthetic organism(s) that contains a heat — and light — responsive promoter-controlled and nirA-promoter-controlled pathway(s) such as the designer transgenic Prochlorococcus that contains a set of designer groE-pro — moter-controlled and nirA-promoter-controlled Calvin-cycle 3-phophoglycerate — branched pathway genes of SEQ ID NOS: 110-118 (listed in US Patent Application Publication No. 2011/0177571 A1), light and heat are used in conjunction with nitrate addition to induce the expression of the designer pathway genes for photo­biological production of isobutanol from carbon dioxide and water (Fig. 6).

According to another embodiment, use of designer marine algae or marine oxy — photobacteria enables the use of seawater and/or groundwater for photobiological production of biofuels without requiring freshwater or agricultural soil. For exam­ple, designer P. marinus that contains the designer genes of SEQ ID NOS: 110-117 and 119-122 (listed in US Patent Application Publication No. 2011/0177571 A1) can use seawater and/or certain groundwater for photoautotrophic growth and syn­thesis of 3-methyl-1-butanol from carbon dioxide and water with its groE promoter — controlled designer Calvin-cycle-channeled pathway (identified as 34 (native), 35,

3- 05, 53-55, 38-40, 42, and 57 in Fig. 6). The designer photosynthetic organisms can be used also in a sealed photobioreactor that is operated on a desert for produc­tion of isobutanol with highly efficient use of water since there will be little or no water loss by evaporation and/or transpiration that a common crop system would suffer. That is, this embodiment may represent a new generation of renewable energy (butanol and related higher alcohols) production technology without requir­ing arable land or freshwater resources.

According to another embodiment, use of nitrogen-fixing designer oxyphotobac — teria enables photobiological production of biofuels without requiring nitrogen fer­tilizer. For example, the designer transgenic Nostoc that contains designer hox-promoter-controlled genes of SEQ ID NOS: 104-109 (listed in US Patent Application Publication No. 2011/0177571 A1) is capable of both fixing nitrogen (N2) and photobiologically producing 2-methyl-1-butanol from carbon dioxide and water (Fig. 6). Therefore, use of the designer transgenic Nostoc enables photoauto­trophic growth and 2-methyl-1-butanol synthesis from carbon dioxide and water without requiring nitrogen fertilizer.

Certain designer oxyphotobacteria are designed to perform multiple functions. For example, the designer transgenic Cyanothece that contains designer nirA pro­moter-controlled genes of SEQ ID NOS: 123-127 (listed in US Patent Application Publication No. 2011/0177571 A1) is capable of (1) using seawater, (2) N2 fixing nitrogen, and photobiological producing 1-hexanol from carbon dioxide and water (Fig. 8). Use of this type of designer oxyphotobacteria enables photobiological pro­duction of advanced biofuels such as 1-hexanol using seawater and without requir­ing nitrogen fertilizer.

According to one of various embodiments, a method for photobiological produc­tion and harvesting of butanol and related higher alcohols comprises: (a) introduc­ing a transgenic photosynthetic organism into a photobiological reactor system, the transgenic photosynthetic organism comprising transgenes coding for a set of enzymes configured to act on an intermediate product of a Calvin cycle and to convert the intermediate product into butanol and related higher alcohols; (b) using reducing power and energy associated with the transgenic photosynthetic organism acquired from photosynthetic water splitting and proton gradient-coupled electron transport process in the photobioreactor to synthesize butanol and related higher alcohols from carbon dioxide and water; and (c) using a product separation process to harvest the synthesized butanol and/or related higher alcohols from the photobioreactor.

In summary, there are a number of embodiments on how the designer organisms may be used for photobiological butanol (and/or related higher alcohols) produc­tion. One of the preferred embodiments is to use the designer organisms for direct photosynthetic butanol production from CO2 and H2O with a photobiological reac­tor and butanol-harvesting (filtration and distillation/evaporation) system, which includes a specific operational process described as a series of the following steps:

(a) growing a designer transgenic organism photoautotrophically in minimal culture medium using air CO2 as the carbon source under aerobic (normal) conditions before inducing the expression of the designer butanol-production-pathway genes;

(b) when the designer organism culture is grown and ready for butanol production, sealing or placing the culture into a specific condition to induce the expression of designer Calvin-cycle-channeled pathway genes; (c) when the designer pathway enzymes are expressed, supplying visible light energy such as sunlight for the designer-genes-expressed cells to work as the catalysts for photosynthetic produc­tion of butanol and/or related higher alcohols from CO2 and H2O; (d) harvesting the product butanol and/or related higher alcohols by any method known to those skilled in the art. For example, harvesting the butanol and/or related higher alcohols from the photobiological reactor can be achieved by a combination of membrane filtration and distillation/evaporation butanol-harvesting techniques.

The above process to use the designer organisms for photosynthetic production and harvesting of butanol and related higher alcohols can be repeated for a plurality of operational cycles to achieve more desirable results. Any of the steps (a)-(d) of this process described earlier can also be adjusted in accordance with the invention to suit for certain specific conditions. In practice, any of the steps (a)-(d) of the process can be applied in full or in part, and/or in any adjusted combination as well for enhanced photobiological production of butanol and higher alcohol in accor­dance with this invention.

In addition to butanol and/or related higher alcohols production, it is also possi­ble to use a designer organism or part of its designer butanol (higher alcohols) pro­duction pathway(s) to produce certain intermediate products of the designer Calvin-cycle-channeled pathways (Figs. 1 and 4-10) including (but not limited to): butyraldehyde, butyryl-CoA, crotonyl-CoA, 3-hydroxybutyryl-CoA, acetoacetyl-CoA, acetyl-CoA, pyruvate, phosphoenolpyruvate, 2-phosphoglycerate, 1,3-diphospho — glycerate, glyceraldehye-3-phosphate, dihydroxyacetone phosphate, fructose-1,6- diphosphate, fructose-6-phosphate, glucose-6-phosphate, glucose, glucose-1- phosphate, citramalate, citraconate, methyl-D-malate, 2-ketobutyrate, 2-ketovalerate, oxaloacetate, aspartate, homoserine, threonine, 2-keto-3-methylvalerate, 2-methyl — butyraldehyde, 3-methylbutyraldehyde, 4-methyl-2-oxopentanoate, 3-isopropylmalate,

2- isopropylmalate, 2-oxoisovalerate, 2,3-dihydroxy-isovalerate, 2-acetolactate, isobutyraldehyde, 3-keto-C6-acyl-CoA, 3-hydroxy-C6-acyl-CoA, C6-enoyl-CoA,

C6-acyl-CoA, 3-keto-C8-acyl-CoA, 3-hydroxy-C8-acyl-CoA, C8-enoyl-CoA, C8-acyl-CoA, octanal, 1-pentanol, 1-hexanal, 1-heptanal, 2-ketohexanoate, 2-keto — heptanoate, 2-ketooctanoate, 2-ethylmalate, 3-ethylmalate, 3-methyl-1-pentanal,

4- methyl-1-hexanal, 5-methyl-1-heptanal, 2-hydroxy-2-ethyl-3-oxobutanoate,

2,3- dihydroxy-3-methyl-pentanoate, 2-keto-4-methyl-hexanoate, 2-keto-5-methyl — heptnoate, 2-keto-6-methyl-octanoate, 4-methyl-1-pentanal, 5-methyl-1-hexanal,

6- methyl-1-heptanal, 2-keto-7-methyl-octanoate, 2-keto-6-methyl-heptanoate, and 2-keto-5-methyl-hexanoate.

According to one of various embodiments, therefore, a further embodiment com­prises an additional step of harvesting the intermediate products that can be pro­duced also from an induced transgenic designer organism. The production of an intermediate product can be selectively enhanced by switching off a designer — enzyme activity that catalyzes its consumption in the designer pathways. The pro­duction of a said intermediate product can be enhanced also by using a designer organism with one or some of designer enzymes omitted from the designer butanol — production pathways. For example, a designer organism with the butanol dehydro­genase or butyraldehyde dehydrogenase omitted from the designer pathway(s) of Fig. 1 may be used to produce butyraldehyde or butyryl-CoA, respectively. Therefore, the present invention has many applications for production of both advanced biofuels and/or bioproducts.

The life cycle energy analysis of Jatropha biodiesel production was conducted by evaluating direct energy input (such as electricity, diesel, gasoline, fuel oil, palm fiber, palm shell, etc.) and indirect energy input (energy accumulated in fertilizers, agrochemicals, and chemical production, excluding equipment and machinery used in the processes). The net energy value (NEV) and the net energy ratio (NER) can be estimated. The NEV is a measure of the energy gain or loss from the biodiesel used, which is defined as the energy content of the biodiesel minus the nonrenew­able energy used in the life cycle of the biodiesel production [63]. The NER is a ratio of energy output to total energy input for the life cycle of the product [64].

Prueksakorn and Gheewala [64] calculated the energy consumption in every pro­cess in producing 1 kg of Jatropha biodiesel. The energy analysis results of the present situation of Jatropha biodiesel production compared to palm oil methyl ester is shown in Table 5. The results show that the selected biodiesel production process determines energy efficiency and environmental impacts.

9 Conclusions

High cost of biodiesel production is the major impediment to its large-scale com­mercialization. Methods to reduce the production cost of Jatropha biodiesel must be developed. One way to reduce production costs is to increase the added values of protein-rich Jatropha seedcakes, by-product of oil extraction, through detoxification process. The development of integrated biodiesel production process and the detoxification process results in two products, namely biodiesel and protein-rich seedcakes that can be used for animal feed. Assuming that an average seed yield on land of 5 tons/ha/year (2 tons/acre/year) could be achieved, the estimated theoretical maximum yield of biodiesel would be 750 kg/acre/year and seedcake products would be 500 kg/acre/year.

Since the cost and efficiency of the selected process will be closely correlated with the production for a long time and affect the capital and operating costs and the environmental load of the product, selecting an appropriate process for the biodiesel production is a critical decision. There are still many future potential improvement of biodiesel production of J. curcas. These include (1) development of better and cheaper oil extraction and postreaction processing methods; (2) development of better and cheaper catalysts; (3) improvements in current technology for producing high-quality biodiesel with cheaper cost production; (4) development of technology to use methanol/ethanol in in situ extraction and transesterification; (5) develop­ment of technique to improve fuel stability of Jatropha biodiesel; (6) conversion of by-products, such as glycerol and seedcake to useful and value-added products, such as methanol and ethanol or glycerol tert-butyl ether (GTBE); and (7) develop­ment of integrated Jatropha biodiesel processing and detoxification process.

LCA has become an important decision-making tool for promoting alternative fuels because it can systematically analyze the fuel life cycle in terms of energy efficiency and environmental impacts. LCA analysis shows that the selected biodie­sel production process determines energy efficiency and environmental impacts of Jatropha biodiesel production.

Depending on the degree of drying during the pre-treatment step, the state of the microalgal cells during lipid extraction can be either a wet paste (approximately 10-30 wt.% solid) or dried powder. During lipid extraction, lipid molecules are extracted out of the microalgal cells and separated from the cellular matrix.

The isolated lipids are often referred to as extracts or analytes. The selected lipid extraction method has to be lipid-specific in order to minimize the co-extraction of non-lipid contaminants (proteins, carbohydrates) and be able to exhibit some degree of selectivity towards biodiesel-convertible neutral lipid fractions (acylglycerols) in order to minimize the downstream removal of unusable lipid components (polar lipids and non-saponifiable neutral lipids) [39]. Additionally, the method should be efficient (both in terms of time and energy), non-reactive with the lipids, and rela­tively safe [30] . The practice of completely drying microalgal wet paste prior to lipid extraction is energetically prohibitive and needs to be avoided. As a conse­quence, the selected lipid extraction method needs to be effective when applied directly to microalgal wet paste. Two of the most commonly used microalgal lipid extraction technologies are reviewed: traditional organic solvent extraction and emerging supercritical fluid extraction.

The fraction of aromatic bridgehead carbons (Xbndge) is closely related to aromatic cluster sizes [3, 14]. If the fraction of carbons along the edges of aromatic rings is Xedge, then

X bridge 1 X edge

Note that Xedge decreases with increasing aromatic cluster sizes. For biochars with dominant aromatics, most of the aromatic edge carbons are aromatic C-H and aromatic C-O functional groups. The fraction of aromatic C-H, xch /aC^/ar

and that of aromatic C-O, xc-o = fac-o / far, can be determined based on the quanti­tative 13C DP spectra using the techniques as shown in Sect. 4. Note that /aCH, /aC-O and /ar are the percentages of protonated aromatics, aromatic C-O and aromaticity,
respectively. The sum of the fractions of aromatic C-H and aromatic C-O gives the minimum aromatic edge fraction,

Xedge, min %CH + %C-O (2)

Correspondingly, the maximum bridgehead-carbon fraction would be

Xbridge, max 1 Xedge, min.

In addition, alkyl C and C=O bonded to the aromatic rings can contribute to the edge carbon fraction. Similar to %ch and Xc-o, their fractions can be expressed as Xalkyl and Xc = o, respectively. With them, we can determine a meaningful upper limit to the edge fraction of biochars,

X edge, max X edge, min + X alkyl + X C = O

With Xedge, max, we can provide a lower limit to the number carbons in an aromatic cluster because along the lines of Solum et al. [24] it can be shown that

nc, min ^ 6 6 Xe2dge ^ 6 6 Xe2dge, max (4)

where n„ is the minimum number of carbons in an aromatic cluster.

C, min

With the nCmin, we can propose rough models of the aromatic cluster for a bio­char. Moreover, using ‘H-13C recoupled long-range dipolar dephasing technique, we can fine-tune the models. In order to achieve this, model compounds with known C-H distances or aromatic cluster sizes are included for calibration.

Adoption of slow-pyrolysis technology may eventually occur within stand-alone businesses whose core business is the production of biochar. It is likely however that the first projects will be driven by the advantages gained through integration with existing industry, which makes the technology more economically viable in the short-term. Case studies have been developed to explore how some major existing industries may utilize pyrolysis technology to overcome some of the challenges they face. Each industry examined in the case studies has a unique organics resource to manage. Resource recovery, energy security, greenhouse gas savings, and economic outcomes for each industry are discussed using a comparison between adoption of a slow-pyrolysis solution and business-as-usual.