The envisioned transgenic designer algae comprise switchable transgenes wherein each transgene encodes for a proton-conductive channel in the algal photosynthetic thylakoid membrane for enhanced photobiological H2 production. The programma­ble genetic insertion of proton channels into algal thylakoid membrane is achieved by transformation of a host alga with a DNA construct that contains a designer polypeptide proton-channel gene linked with an externally inducible promoter such as a redox-condition-sensitive hydrogenase promoter serving as a genetic switch.

Examples of proton-conductive polypeptide or protein structures that can be used and/or modified for this application are the structures of melittin, gramicidin [18], CF0 protein (the proton channel of chloroplast coupling factor CF0CF1), F0 protein (the proton-channel structure of mitochondrial coupling factor FoF1), and their analogs including artificially designed polypeptide proton channels. That is, the molecular structure (and thus the DNA sequence) of a polypeptide proton chan­nel can be designed according to these natural proton-channel structures and their analogs at a nanometer scale. Melittin is preferred for use in this application since in vitro assay has already demonstrated that melittin can work as a proton channel in thylakoid membrane [19].

As shown in Fig. 4a, the designer proton-channel transgene is a nucleic acid construct from 5′ to 3′ comprising typically: (a) a polymerase chain reaction forward (PCR FD) primer; (b) an externally inducible promoter; (c) a transit target­ing sequence; (d) a designer proton-channel encoding sequence; (e) a transcription and translation terminator; and (f) a PCR reverse (RE) primer.

Another aspect is the innovative application of an externally inducible promoter such as a hydrogenase promoter. To function as intended, the designer proton-chan­nel protein is inducibly expressed under hydrogen-producing conditions such as under anaerobic conditions. An algal hydrogenase promoter, such as the promoter of the hydrogenase gene (Hydl) of C. reinhardtii, can be used as an effective genetic switch to control the expression of the proton channel gene to the exact time and conditions where it is needed for H, production. That is, the proton channels are synthesized only at the time when the hydrogenase is induced and ready for H, production under anaerobic conditions. Therefore, the hydrogenase promoter is employed as an inducible promoter for the DNA construct (Fig. 4a) to serve as a genetic switch to control the expression of the designer polypeptide proton-channel gene. The reason that the designer alga can perform autotrophic photosynthesis using CO, as the carbon source under aerobic condition is because the designer proton-channel gene is not expressed under aerobic conditions owning to the use of a hydrogenase promoter as a genetic switch, which can be turned on only under the anaerobic conditions when needed for photobiological H2 production.

In addition to the hydrogenase promoter, other promoters can also be used to construct the desired genetic switch for designer proton-channel gene. Chlamydomonas cells contain several nuclear genes that are coordinately induced under anaerobic conditions. These include the hydrogenase structural gene itself (Hydl), the Cyc6 gene encoding the apoprotein of Cytochrome c, , and the Cpxl gene encoding coprogen oxidase [20]. The regulatory regions for the latter two have been well characterized, and a region of ~100 bp proves sufficient to confer regula­tion by anaerobiosis in synthetic gene constructs. The promoter strengths of these three genes vary considerably; each may thus be selected to control the level of the designer proton-channel expression for enhanced photobiological production of H2. There are a number of other regulated promoters that can also be used and/or modified to serve as the genetic switches. For example, the nitrate reductase (Nia1)

Fig. 4 (a) The general design of the DNA construct for a designer proton-channel gene. (b) A photograph for the first set of designer proton channel genes that were synthesized in collaboration with Geneart

promoter which is induced by growth in nitrate medium and repressed in nitrate — deficient but ammonium-containing medium is used to control the expression of the designer genes according to the concentration levels of nitrate in a culture medium as well. Therefore, inducible promoters that can be used and/or modified in various embodiments to serve this purpose includes, but are not limited to, hydrogenase promoters, Cytochrome c6 (Cyc6) promoter, Nial promoter, CabII-1 promoter, Cal promoter, Ca2 promoter, coprogen oxidase promoter, and/or their analogs and modi fi ed designer sequences.

Another aspect is the targeted insertion of designer proton channels into algal photosynthetic membrane or into both the photosynthetic membrane and other cel­lular membranes including the mitochondria and/or plasma membranes to suit for the specific applications. For example, in the case of green algae including Chlamydomonas, when recyclable growth of the designer algae culture is desired, it is best to insert the proton channels only into the algal thylakoid membrane, exactly where the action of proton channels is needed to enhance H2 production. If expressed without a targeted insertion mechanism, the polypeptide proton channels might be inserted nonspecifically into other membrane systems including the mitochondria and plasma membranes in addition to the thylakoid membranes. Although an expression of the proton channel gene in such a nonspecific manner could still trans­form an algal cell into a more efficient and robust photosynthetic apparatus for H2 production, other cellular functions such as the respiratory process would probably be disabled because of the potential effect of the proton channels that are nonspecifically inserted into other organelles such as the mitochondria. As a result, this type of algal cells with insertion of the proton channels into both the photosyn­thetic membrane and other cellular membranes, such as the mitochondrial mem­branes, can still be used for enhanced H2 production, but the cells would probably no longer be able to grow or regenerate themselves after the expression of the designer proton channels is turned on. That is, when the expression of the designer proton channels is turned on in this type of nonregenerative proton-channel designer algae, the algal culture will become dedicated “green machine” materials for enhanced H2 production and the cells will no longer be able to grow even if they are returned to aerobic condition because the other cellular functions such as the func­tion of the mitochondria are impaired by the insertion of proton channels.

This nonregenerative feature provides a benefit: help ensure biosafety in using the genetically modified algae. This is because after the designer proton channels are inserted into both the photosynthetic membrane and the mitochondrial mem­branes, the designer algal cells become dedicated nonliving “green machine” mate­rials for enhanced H2 production, but without any potential risks of sexually passing any of their genes to any other cells. In various embodiments, the nonregenerative feature is achieved by use of two designer proton-channel genes: one with a mito­chondrial-targeting sequence to insert proton channels into the algal mitochondrial membrane and one with a thylakoid-targeting sequence to insert proton channels into the algal thylakoid membrane. When the two designer proton-channel genes are both expressed, the designer cells immediately become dedicated nonliving “green machine” materials for enhanced H2 production. Therefore, in one embodi­ment, it is a preferred practice to keep growing this type of nonregenerative proton — channel designer under aerobic conditions to continuously supply batches of grown designer algal cultures that are subsequently used for enhanced H2 production expression of the proton channels into both the photosynthetic membrane and other cellular membranes such as the mitochondrial membranes under anaerobic condi­tions. After the nonregenerative proton-channel designer algal cultures are used for enhanced H2 production under anaerobic conditions, they can be quite safely han­dled as nonliving biomass materials for disposal including possible use as a fertil­izer or other biomass processes.

With a thylakoid-targeted mechanism that enables insertion of the polypeptide proton channels only into the thylakoid membrane so that all of the other cellular functions (including functions of the mitochondria, nucleus, and cell membranes) are kept intact, the result can be much better for certain applications. After the thy — lakoid-targeted insertion of proton channels, the cell will not only be able to pro­duce H2 , but also to grow and regenerate itself when it is returned to aerobic conditions. Our daily experience with photoheterotrophically grown photosynthetic mutants of algae with acetate-containing culture media has demonstrated that this type of designer alga, which contains normal mitochondria, should be able to use the reducing power (NADH) from organic reserves (and/or some exogenous organic substrate such as acetate) to power the cell immediately after its return to aerobic conditions. Consequently, when the alga is returned to aerobic conditions after its use under anaerobic conditions for photoevolution of H2 and O2, the cell will stop making the polypeptide proton channels and start to restore its normal photoauto­trophic capability by synthesizing new and functional thylakoids. Consequently, it is also possible to use this genetically transformed organism for repeated cycles of photoautotrophic growth under normal aerobic conditions and efficient production of H2 and O2 by photosynthetic water splitting under anaerobic conditions.

Targeted insertion of designer proton channel is accomplished through the use of a specific targeting DNA sequence that is located between the promoter and the designer proton-channel DNA as shown in the DNA construct (Fig. 4a). In various embodiments, there are a number of transit peptide sequences that can be selected and/or modified for use as the targeting sequence for the targeted insertion of the designer proton channels into algal photosynthetic membrane and, when desirable, other cellular membranes, such as mitochondrial membrane. The targeting sequences that can be used and/or modified for this purpose include (but are not limited to) the transit peptide sequences of: plastocyanin apoprotein (Pcyl), the LhcII apoproteins, OEE1 apoprotein (PsbO) , OEE2 apoprotein (PsbP) , OEE3 apoprotein (PsbQ), hydrogenase apoproteins (such as Hydl), PSII-T apoprotein (PsbT), PSII-S apopro­tein (PsbS), PSII-W apoprotein (PsbW), CF0CF1 subunit-g apoprotein (AtpC), CF0CF1 subunit-5 apoprotein (AtpD), CF0CF1 subunit-II apoprotein (AtpG), photo­system I (PSI) apoproteins (such as, of genes PsaD, PsaE, PsaF, PsaG, PasH, and PsaK), Rubisco SSU apoproteins (such as RbcS2), a-tubulin (TubA), b-tubulin (TubB2), mitochondrial carbonic anhydrase apoproteins (Ca1 and Ca2), and/or their analogs and modified designer sequences.

The following are examples of transit peptide sequences that could be chosen to guide the genetic insertion of the designer proton channels into algal thylakoid membrane: (1) The transit peptide from the plastocyanin gene targets the lumen of the thylakoids from which the biochemical properties of the designer proton-chan­nel polypeptide may again generate insertion into the thylakoid membrane; (2) The Hydl transit peptide confers importation of polypeptides into the stroma, from which the biochemical properties of the designer proton-channel protein may gener­ate insertion into the thylakoid; (3) The transit peptides from the recently character­ized Lhcb gene family members [21] lead the LhcII apoproteins directly to the thylakoid and may also do so for the designer proton-channel polypeptide in an artificial construct; and (4) The transit peptide from the Cyc6 gene targets the lumen of the thylakoids from which the biochemical properties of the designer proton — channel polypeptide may again generate insertion into the thylakoid.

As illustrated in Fig. 4a, the designer DNA construct also contains a terminator after the proton-channel encoding sequence and a pair of PCR [22] primers located each at the two ends of the DNA construct. The terminator DNA sequence, which is designed based on the sequences of natural gene terminators, is to ensure that the transcription and translation of the said designer proton-channel gene is properly terminated to produce an exact designer proton-channel protein as desired.

The two PCR primers are a PCR FD primer located at the beginning (the 3′ end) of the DNA construct and a PCR RE primer located at the other end as shown in Fig. 4a. This pair of PCR primers is designed to provide certain convenience when needed for relatively easy PCR amplification of the designer DNA construct, which is helpful not only during and after the designer DNA construct is synthesized in preparation for gene transformation, but also after the designer DNA construct is delivered into the genome of a host alga for verification of the designer proton — channel gene in the transformants. For example, after the transformation of the designer gene is accomplished in a C. reinhardtii-arg7 host cell using the techniques of electroporation and argininosuccinate lyase (arg7) complementation screening, the resulted transformants can be then analyzed by a PCR DNA assay of their nuclear DNA using this pair of PCR primers to verify whether the entire designer proton-channel gene (the DNA construct) is successfully incorporated into the genome of a given transformant. When the nuclear DNA PCR assay of a transfor­mant can generate a PCR product that matches with the predicted DNA size and sequence according to the designer DNA construct, the successful incorporation of the designer proton-channel gene into the genome of the transformant is verified.

Using the molecular genetics arts described above, we designed and synthesized a number of designer proton-channel genes in collaboration with certain gene-syn­thesizing companies including Geneart USA. Figure 4b shows our first set of designer proton channel genes that were synthesized through collaboration with Geneart. The following presents some examples of the designer proton-channel genes (DNA constructs) that have synthesized and tested in genetic transformation experiments.

Figure 5a presents SEQ ID No. 1: example 1ofa detailed DNA construct of a designer proton-channel gene that includes a PCR FD primer (1-20), a 458-bp HydAl promoter (21-478), a Plastocyanin transit peptide DNA sequence (479-618), a Melittin DNA sequence (619-703), an RbcS2 terminator (704-926), and a PCR RE primer (927-945). This DNA construct (example 1) has been delivered into the nuclear genome of a C. reinhardtii-arg7 host cell using the techniques of electropo­ration and arg7 complementation screening to create the proton-channel designer alga. The 458-bp HydA1 promoter (DNA sequence 21-478) is used as an example of an inducible promoter to control the expression of a Melittin proton channel (DNA sequence 619-703). The RbcS2 terminator (DNA sequence 704-926) is employed to ensure that the transcription and translation of the proton-channel gene is properly terminated to produce the exact designer proton-channel protein

a

AGAAAATCTGGCACCACACCAT AAGGGTCAT AGAATCT AGCGTT ATCCTTCCA

CGAGCGTGTGGCAGCCTGCTGGCGTGGACGAGCTGTCATGCGTTGTTCCGTTAT

GTGTCGTCAAACGCCTTCGAGCGCTGCCCGGAACAATGCGTACTAGTATAGGA

GCCATGAGGCAAGTGAACAGAAGCGGGCTGACTGGTCAAGGCGCACGATAGG

GCTGACGAGCGTGCTGACGGGGTGTACCGCCGAGTGTCCGCTGCATTCCCGCC

GGATTGGGAAATCGCGATGGTCGCGCATAGGCAAGCTCGCAAATGCTGTCAGC

TTATCTTACATGAACACACAAACACTCTCGCAGGCACTAGCCTCAAACCCTCGA

AACCTTTTTCCAACAGTTTACACCCCAATTCGGACGCCGCTCCAAGCTCGCTCC

GTTGCTCCTTCATCGCACCACCTATTATTTCTAATATCGTAGACGCGACAAG^rG

AAGGCTACTCTGCGTGCCCCCGCTTCCCGCGCCAGCGCTGTGCGCCCCGTCGCC

AGCCTGAAGGCCGCTGCTCAGCGCGTGGCCTCGGTCGCCGGTGTGTCGGTTGCC

TCTCTGGCCCTGACCCTGGCTGCCCACGCCATGGCCGGCATCGGCGCCGTGCTG

AAGGTCCTGACCACCGGCCTGCCCGCCCTGATCAGCTGGATCAAGCGCAAGCG

CCAGCAGTAAATGGAGGCGCTCGTTGATCTGAGCCTTGCCCCCTGACGAACGG

CGGTGGATGGAAGATACTGCTCTCAAGTGCTGAAGCGGTAGCTTAGCTCCCCGT

TTCGTGCTGATCAGTCTTTTTCAACACGTAAAAAGCGGAGGAGTTTTGCAATTT

TGTTGGTTGTAACGATCCTCCGTTGATTTTGGCCTCTTTCTCCATGGGCGGGCTG

GGCGTATTTGAAGCGGTTCTCTCTTCTGCCGTT

b

AGAAAATCTGGCACCACACCGAGCTGTCATGCGTTGTTCCGTTATGTGTCGTC

AAACGCCTTCGAGCGCTGCCCGGAACAATGCGTACTAGTATAGGAGCCATGAG

GCAAGTGAACAGAAGCGGGCTGACTGGTCAAGGCGCACGATAGGGCTGACGA

GCGTGCTGACGGGGTGTACCGCCGAGTGTCCGCTGCATTCCCGCCGGATTGGG

AAATCGCGATGGTCGCGCATAGGCAAGCTCGCAAATGCTGTCAGCTTATCTTAC

ATGAACACACAAACACTCTCGCAGGCACTAGCCTCAACTCGAGCAT^rGAAGG

CTACTCTGCGTGCCCCCGCTTCCCGCGCCAGCGCTGTGCGCCCCGTCGCCAGCC

TGAAGGCCGCTGCTCAGCGCGTGGCCTCGGTCGCCGGTGTGTCGGTTGCCTCTC

TGGCCCTGACCCTGGCTGCCCACGCCATGGCCGGCATCGGCGCCGTGCTGAAG

GTCCTGACCACCGGCCTGCCCGCCCTGATCAGCTGGATCAAGCGCAAGCGCCA

GCAGTAATCTAGATAAATGGAGGCGCTCGTTGATCTGAGCCTTGCCCCCTGACG

AACGGCGGTGGATGGAAGATACTGCTCTCAAGTGCTGAAGCGGTAGCTTAGCT

CCCCGTTTCGTGCTGATCAGTCTTTTTCAACACGTAAAAAGCGGAGGAGTTTTG

CAATTTTGTTGGTTGTAACGATCCTCCGTTGATTTTGGCCTCTTTCTCCATGGGC

GGGCTGGGCGTATTTGAAGCGGTTCTCTCTTCTGCCGTT

Fig. 5 (a) DNA sequence IDNo. 1: A detailed DNA construct of a designer proton-channel gene (945 bp) that includes a polymerase chain reaction forward (PCR FD) primer (1-20), a 458-bp HydAl promoter (21-478), a Plastocyanin transit peptide DNA sequence (479-618), a Melittin DNA sequence (619-703), an RbcS2 terminator (704-926), and a PCR reverse (RE) primer (927­945). (b) DNA sequence ID No. 2: A designer proton-channel gene sequence design (787 bp) that includes (from 5′ to 3′): a PCR FD primer (sequence 1-20), a 282-bp HydAl promoter (21-302), a Xho I Ndel site (303-311), a Plastocyanin transit peptide sequence (312-452), a Melittin proton channel (453-536), a Xbal site (537-545), a RbcS2 terminator (546-768), and a PCR RE primer (769-787). (c) DNA sequence ID No. 3: A designer proton-channel gene sequence design (972 bp) that includes (from 5′ to 3 ‘): a PCR FD primer (1-20), a 458-bp HydAl promoter (21-478), a HydAl transit peptide (479-646), a Melittin (647-730), an RbcS2 terminator (731-953), and a PCR RE primer (954-972)

c

AGAAAATCTGGCACCACACCATAAGGGTCATAGAATCTAGCGTTATCCTTCCA

CGAGCGTGTGGCAGCCTGCTGGCGTGGACGAGCTGTCATGCGTTGTTCCGTTAT

GTGTCGTCAAACGCCTTCGAGCGCTGCCCGGAACAATGCGTACTAGTATAGGA

GCCATGAGGCAAGTGAACAGAAGCGGGCTGACTGGTCAAGGCGCACGATAGG

GCTGACGAGCGTGCTGACGGGGTGTACCGCCGAGTGTCCGCTGCATTCCCGCC

GGATTGGGAAATCGCGATGGTCGCGCATAGGCAAGCTCGCAAATGCTGTCAGC

TTATCTTACATGAACACACAAACACTCTCGCAGGCACTAGCCTCAAACCCTCGA

AACCTTTTTCCAACAGTTTACACCCCAATTCGGACGCCGCTCCAAGCTCGCTCC

GTTGCTCCTTCATCGCACCACCTATTATTTCTAATATCGTAGACGCGACAAGAT

GTCGGCGCTCGTGCTGAAGCCCTGCGCGGCCGTGTCTATTCGCGGCAGCTCCTG

CAGGGCGCGGCAGGTCGCCCCCCGCGCTCCGCTCGCAGCCAGCACCGTGCGTG

TAGCCCTTGCAACACTTGAGGCGCCCGCACGCCGCCTAGGCAACGTCGCTTGCG

CGGCTATGGCCGGCATCGGCGCCGTGCTGAAGGTCCTGACCACCGGCCTGCCC

GCCCTGATCAGCTGGATCAAGCGCAAGCGCCAGCAGTAAATGGAGGCGCTCGT

TGATCTGAGCCTTGCCCCCTGACGAACGGCGGTGGATGGAAGATACTGCTCTCA

AGTGCTGAAGCGGTAGCTTAGCTCCCCGTTTCGTGCTGATCAGTCTTTTTCAAC

ACGTAAAAAGCGGAGGAGTTTTGCAATTTTGTTGGTTGTAACGATCCTCCGTTG

ATTTTGGCCTCTTTCTCCATGGGCGGGCTGGGCGTATTTGAAGCGGTTCTCTCT

TCTGCCGTT

Fig. 5 (continued) (Melittin) as desired. Because the HydAl promoter is a nuclear DNA that can con­trol the expression only for nuclear genes, the synthetic proton-channel gene in this example is designed according to the codon usage of Chlamydomonas nuclear genome. Therefore, in this case, the designer proton-channel gene is transcribed in nucleus. Its mRNA is naturally translocated into cytosol, where the mRNA is trans­lated to an apoprotein that consists of the Melittin protein (corresponding to DNA sequence 619-703) and the Plastocyanin transit peptide (corresponding to DNA sequence 479-618) linked together. The transit peptide of the apoprotein guides its transportation across the chloroplast membranes and into the thylakoids, where the transit peptide is cut off from the apoprotein and the resulting free melittin (poly­peptide proton channel) insert itself into the thylakoid membrane from the lumen side. The action of the designer proton channel in the thylakoid membranes then provides the benefit of simultaneously eliminating the four proton gradient-related problems in relation to photobiological H2 production. The two PCR primers (sequences 1-20 and 927-945) are selected from the sequence of a Human actin gene and can be paired with each other. Blasting the sequences against Chlamydomonas GenBank found no homologous sequences of them. Therefore, they can be used as appropriate PCR primers in DNA PCR assays for verification of the designer proton-channel gene in the transformed alga.

Figure 5b presents SEQ ID No. 2: example 2ofa designer proton-channel DNA construct that includes a PCR FD primer (sequence 1-20), a 282-bp HydAl promoter (21-302), a Xho I Ndel site (303-311), a Plastocyanin transit peptide sequence (312-452), a Melittin proton channel (453-536), a XbaI site (537-545), a RbcS2 terminator (546-768), and a PCR RE primer (769-787). This designer proton chan­nel gene (example 2) is quite similar to example 1, SEQ ID No: 1, except that a shorter promoter sequence is used and restriction sites of Xho I Ndel and XbaI are added to make the key components such as the targeting sequence (312-452) and proton channel (453-536) as a modular unit that can be flexible replaced when nec­essary to save cost of gene synthesis and enhance work productivity. Note, the proton channel does not have to be a Melittin; a number of other proton-channel structures such as a gramicidin analog channel can also be used. This designer proton-channel gene (SEQ ID No: 2) has also been successfully delivered into the nuclear genome of a C. reinhardtii-arg7 host cell using the techniques of electroporation and arg7 complementation screening to create the proton-channel designer alga.

Figure 5c presents SEQ ID No. 3: example 3ofa designer proton-channel DNA construct that includes a PCR FD primer (1-20), a 458-bp HydAl promoter (21­478), a HydA1 transit peptide (479-646), a Melittin (647-730), an RbcS2 terminator (731-953), and a PCR RE primer (954-972). This designer proton-channel gene (example 3) is also similar to example 1, with the exception that a HydA1 transit peptide sequence (479-646) is used here so that the proton channel protein is syn­thesized in the cytosol, delivered into the chloroplast, and inserted into the thylakoid membrane from the stoma side. This designer proton-channel gene (SEQ ID No: 3) has also been successfully delivered into the nuclear genome of an algal host cell to create the proton-channel designer alga.

Using these designer proton channel genes in genetic transformation of C. rein — hardtii host cells, many transformants have been generated (Fig. 6). Theoretically, these transformants are expected to contain the envisioned proton-channel designer alga that could provide significant impact (tenfold improvement) on technology development in the field of renewable photobiological H2 production. Next, we need to screen/characterize these transformants to identify and optimize the desired pro­ton-channel designer alga with iterative improvement through our progressive feed­back approach of computer-assisted molecular design, designer gene expression, and experimental characterization/verification until the desired result for enhanced photobiological H2 production is achieved.