Community DNA was obtained from samples by using a kit for extracting DNA from soil samples, e. g. UltraClean Soil DNA (Mo Bio Laboratories, USA), which includes different scales, and their use is recommend depending on the sample condition.

1.2.1 16S rDNA Clone Analysis

Construction of 16S rDNA Clone Library

Community DNA was used as the template DNA. Bacterial partial 16S rDNA (about 1,500 bp) was amplified by PCR with a forward primer B27F (5′- AGAGTTTGATCCTGGCTCAG, Escherichia coli position 9-27) and a reverse primer U1492RM (5′-GGYTACCTTGTTACGACTT, E. coli position 1512-1492) [17]. Amplification by PCR comprised 25 cycles of 30 s at 94°C, 30 s at 60°C, 1.5 min at 72°C, and a final extension of 5 min at 72°C using Ex Taq DNA polymerase (Takara Bio, Japan). PCR products were purified using a DNA purifi­cation kit (e. g. GFX PCR DNA and Gel Band Purification Kit, GE Healthcare, UK) and cloned into the plasmid vector (e. g. pT7Blue T-Vector, Novagen, Germany).

Transformation of E. coli and Sequencing of 16S rDNA Clone Library

E. coli strain DH5 alpha was transformed with this plasmid library. Plasmid DNAs were prepared from the cultures. The 16S rDNAs were sequenced using an appropriate DNA sequencer (e. g. DNA Analyzer 3730 xl, Applied Biosystems, USA).

Homology Search and Estimation of Phylogenetic Affiliations

A homology search was conducted using BLASTN database (BLAST, http://www. ncbi. nlm. nih. gov/BLAST/) [18]. Checks for chimeric sequences were conducted using the software Pintail [19] which is available from the Ribosomal Database Project, followed by NCBI BLASTN database [18].

Analysis of Homologous Coverage

Coverage of the clone library describes the extent to which the sequences in the library represent the total population. In order to calculate the coverage of a library, the criterion for what constitutes a unique sequence must first be decided. Various studies have used different criteria, generally based on sequence similarity (e. g. 97 or 99% similarity) or evolutionary distance (e. g. < 0.01). These values can then be used to plot a coverage curve (C vs D) that describes how well the library represents the total community given varying criteria of uniqueness. The homologous coverage (Cx) is calculated by the following formula Cx = 1-(Nx/n), where Nx is the number of unique sequences in the sample and n is the total number of sequences [20].

Construction of a Phylogenetic Tree

Sequences are aligned using the Clustal W program version 1.7 [21, 22], and all sites with gaps in any sequences and the regions of PCR primers are removed from the alignment. The phylogenetic trees are constructed by the neighbor-joining method [23] or the maximum-likelihood method [24] using the PHYLIP (Phylogeny Inference Package) program version 3.5c (http://evolution. genetics. washington. edu/phylip. html) [25]. The stability of relationships was assessed by performing bootstrap analyze of the neighbor-joining data based on 1,000 resamplings.